Module 1
The plan
- Create directory and practice moving around. Knowing more about a function
- Download files from repositories
- Manipulate files, piping, parsing, reformatting
- Sequence file formats: Fasta and fastq
- Bed format and regular expressions
Create directory and practice moving around
To create file and folders in linux is quite simple. You can use a number of programs for creating an empty file (touch) or an empty directory (mkdir)
touch my_beautiful_file.txt
mkdir my_beautiful_folder
To display the list of files and folder we can use the command ls
ls
my_beautiful_file.txt my_beautiful_folder
To change the name of a file (or a directory) you can use the command mv while for copying the file you can use cp. Adding the option -r (recursive) to cp allows to copy a whole folder and its content.
mv my_beautiful_file.txt my_ugly_file.txt
mv my_beautiful_folder my_ugly_folder
cp my_ugly_file.txt my_beautiful_file.txt
cp my_ugly_folder -r my_beautiful_folder
If you omit the -r option the system will complain
cp my_ugly_folder my_other_folder
cp: omitting directory ‘my_ugly_folder’
You can use mv also for moving a file (or a directory) inside a folder. Also cp will allow you to make a copy inside a folder.
mv my_beautiful_file.txt my_beautiful_folder
cp my_ugly_file.txt my_ugly_folder
ls
my_beautiful_folder my_ugly_file.txt my_ugly_folder
For entering in a folder we can use the tool cd
cd my_ugly_folder
ls
my_ugly_file.txt
For going out we can move one level out
cd ../
ls
my_beautiful_folder my_ugly_file.txt my_ugly_folder
Sometimes we get lost and would like to know where we are. We can use the command pwd
We can write to a file using the character >, that means output redirection.
echo "ATGTACTGACTGCATGCATGCCATGCA" > my_dna.txt
And display the content of the file using the program cat
cat my_dna.txt
ATGTACTGACTGCATGCATGCCATGCA
To convert this sequence to a RNA one we can just replace the T base with U by using the program sed. The sintax of this program is the following s/<TO BE REPLACED>/<TO REPLACE>/.
You can add a g at the end if you want to replace every character found s/<TO BE REPLACED>/<TO REPLACE>/g.
sed s/T/U/g my_dna.txt > my_rna.txt
cat my_rna.txt
AUGUACUGACUGCAUGCAUGCCAUGCA
Every command has a manual, you can read it by using the program man with the name of the tool.
man ls
LS(1) User Commands LS(1)
NAME
ls - list directory contents
SYNOPSIS
ls [OPTION]... [FILE]...
DESCRIPTION
List information about the FILEs (the current directory by default). Sort entries alphabetically if none of -cftuvSUX nor --sort is specified.
Mandatory arguments to long options are mandatory for short options too.
-a, --all
do not ignore entries starting with .
-A, --almost-all
do not list implied . and ..
--author
with -l, print the author of each file
-b, --escape
print C-style escapes for nongraphic characters
Manual page ls(1) line 1 (press h for help or q to quit)
Recap
- touch writes empty files mkdir empty directories
- mv move files (or directory) or change their name
- ls list files and directories
- cp copy files and direcotries
- cd change the directory
- echo print values to standard output
- cat print the content of a file to standard output
- sed replace a string with another
- man print the manual for a function